circad | circRNAs associated with diseases

hsa_circ_400011/hsa_circ_0092374
Gene	GADD45A	Organism	Human
Genome Locus	chr1:68151221-68151421:+	Build	hg19
Disease	Systemic Lupus Erythematosus	ICD-10	Drug-induced systemic lupus erythematosus (M32)
DBLink	Link to database	PMID	29360436
Experimental Method
Sample Type	Blood samples	Comparison	48 paired plasma samples including twenty-four Systemic Lupus Erythematosus (SLE) patients and 24 normal volunteers
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AACTCCCGCCCTTGCTCCCT Reverse TCCCCTGCAAGCCTTCCACA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Li, H, Li, K, Lai, W, Li, X, Wang, H, Yang, J, Chu, S, Wang, H, Kang, C, Qiu, Y (2018). Comprehensive circular RNA profiles in plasma reveals that circular RNAs can be used as novel biomarkers for systemic lupus erythematosus. Clin. Chim. Acta, 480:17-25.